West Virginia University Genomics Core Facility



Next Generation Sequencing


Library Preparation


Library Type Max number of samples that can be multiplexed in one lane WVU Users Non-WVU Users
Each Sample Each Sample
TruSeq PCR-Free DNA 24 $70 $115
TruSeq RNA 24 $85 $135
TruSeq Small RNA 48 $100 $150
Nextera XT
(Illumina Compatible)
96 $60 $98

Not sure which library prep is best for you? Click here.


Sequencer Runs


Run Type Length WVU User Non-WVU User
V2 Chemsitry
Single End 50 $835 $1,225
Paired End 150 $1,085 $1,576
Paired End 250 $1,210 $1,770
V3 Chemsitry
Paired End 75 $935 $1,355
Paired End 300 $1635 $2,370

We have a collaborative relationship with the Marshall Genomics Core Facility which provides Illumina HiSeq sequencing for libraries prepared in our facility. Please inquire for pricing.



Other Sequencing Services



Service Level Single Sample* Group of 16 Samples** Group of 96 Samples**
Full Service Sequencing - includes sequencing reaction†, cleanup, and run on 3130xl $6.50 $80 $350
Cleanup and Sequencing on 3130xl reaction performed by user $4 $32 $124
Sequencing on 3130xl cleanup and reaction performed by user $3 $18 $90
Run Fragment Analysis Samples on 3130xl User performs reaction and provides size standard $3 $18 $90
RNA Nano 6000 Analysis on Agilent 2100 Bioanalyzer‡ $60/12 sample chip
$75 non-WVU
Bioanalyzer High Sensetivity DNA Chip‡ $75/11 sample chip
$105 non-WVU
Covaris DNA shearing $6 WVU
$8 non-WVU
Illumina Library QC via qPCR $100/1‑12 samples WVU
$150/1‑12 samples non‑WVU
* All samples that are not submitted in multiples of 16 will be charged the single sample price (e.g., if 19 samples are submitted, 16 will be charged at the bulk rate and 3 will be charged at the single sample rate). Such samples may experience a processing delay. If expedited processing is required, an additional fee of $15 can be added.
** We ask that you leave one well open for us to run a positive control.
† Assumes M13 or other standard primers. Custom primers should be provided by individual researchers. Submission conditions vary depending on sample type. Please contact the lab manager for details.
‡ Please provide at least one week of advance notice for use of BioAnalyzer Chips to allow time for ordering, if necessary.

Available Primers


Primer Name Sequence
SP6_Promoter TACGATTTAGGTGACACTATAG
BGH_Reverse TAGAAGGCACAGTCGAGG
CMV_Forward CGCAAATGGGCGGTAGGCGTG
T3_Promoter AATTAACCCTCACTAAAGGG
T7_Promoter TAATACGACTCACTATAGGG
M13_Forward (-20)   GTAAAACGACGGCCAGT
M13_Reverse (-27) CAGGAAACAGCTATGAC
Luc_F AGTCAAGTAACAACCGCGA
LKO.15-Human U6 promoter GACTATCATATGCTTACCGT
SV40pA-R GAAATTTGTGATGCTATTGC
TRIPZ/GIPZ_HairpinSeq GTTTGTTTGAATGAGGCTTC
pGEX_F GGGCTGGCAAGCCACGTTTGGTG
pGEX_R CCGGGAGCTGCATGTGTCAGAGG
CMV_Prom_F TAGGCGTGTACGGTGGGAG





Bioinformatics


All Bioinformatic services are charged at an hourly rate of $30/hr for WVU users and $45/hr for external users. This time includes just the time a Bioinformatician is actively engaged with your data. Computer run time is not charged at this time. Below is a list of common tasks, and an estimate for how long they will take. Note that this is by no means a comprehensive list of what we can do, its just a few easily quantifyable tasks. A few things we can also help with include:
  • Experiment Design
  • Grant Writing
  • Large Data Sets
  • Mining Public Databases
  • Automate Repetative Tasks
  • Publication Quality Figures
  • Interactive Visualizations
  • Custom Analyses
  • Training

Service Estimate
(hours)
RNA-seq
  With reference genome in Ensembl, one comparison, identified samples, less than 16 samples 6
Extra Comparisons + 1
Without a reference 20-40
Metagenomics
16S Metagenomics: classify strains, PCoA, rarefaction, diversity 5
Fungal ITS: classify strains, PCoA, rarefaction, diversity 5
Identify significantly different species + 2
Note: Bioinformatician can easily be bribed with chocolate




All prices subject to change without notice

This is a non-profit center. We charge to cover our costs, nothing more.
Last updated February, 2013